Zebrafish gene: stxbp1b
Human gene: STXBP1 (syntaxin binding protein 1)
Homology score: 72%
ClinVar variants: 158
Gene description: Predicted to have syntaxin-1 binding activity. Predicted to be involved in intracellular protein transport; neurotransmitter secretion; and vesicle docking involved in exocytosis. Predicted to localize to plasma membrane and secretory granule. Is expressed in brain and retina. Used to study early infantile epileptic encephalopathy. Human ortholog(s) of this gene implicated in West syndrome and early infantile epileptic encephalopathy 4. Orthologous to human STXBP1 (syntaxin binding protein 1).
ZFIN link: https://zfin.org/ZDB-GENE-060531-166
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000056036;r=5:28973264-29002258;t=ENSDART00000005638
Zebrafish reference(s): Grone BP, Marchese M, Hamling KR, Kumar MG, Krasniak CS, Sicca F, et al. (2016) Epilepsy, Behavioral Abnormalities, and Physiological Comorbidities in Syntaxin-Binding Protein 1 (STXBP1) Mutant Zebrafish. PLoS ONE 11(3): e0151148. doi:10.1371/journal.pone.0151148
This gene has 2 transcripts (splice variants).
WT DNA sequence (mutation area: exon 1)
Mutant DNA sequence (mutation area: 12 bp deletion in exon 1)
Guide RNA target sites: n/a
Primers:
Forward primer: ATCTGCGTAGAAAGCTGAGCTTCATAG
Reverse primer: GTCAATGAAAATGGCACTAACTCCACACG
WT Protein sequence:
Representative mutant behavior data
N = 87
