Zebrafish gene: slc6a1b

Human gene: SLC6A1 (solute carrier family 6 member 1)

Homology score: 92%

ClinVar variants: 52

Gene description: Predicted to have gamma-aminobutyric acid:sodium symporter activity and neurotransmitter binding activity. Predicted to be involved in taurine transport. Predicted to localize to axon; cell surface; and plasma membrane. Is expressed in basal plate midbrain region and nervous system. Orthologous to human SLC6A1 (solute carrier family 6 member 1).

ZFIN link: https://zfin.org/ZDB-GENE-041114-57​

Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000039647;r=11:997100-1024483;t=ENSDART00000017551​

Zebrafish reference(s): n/a

Sequences: 

This gene has 2 transcripts (splice variants).

Guide RNA target sites: taatacgactcactataGGGCGTAGGATGGACTGGAAgttttagagctagaa

Primers:

Forward primer: gcagagcatttatgtgctggc

Reverse primer: atttgaagcctcgactgtagg

Kaplan-Maier Survival Plot

EEG scoring distribution

N = 84

Representative mutant EEG