Zebrafish gene: scn8aa
Human gene: SCN8A (sodium voltage-gated channel alpha subunit 8)
Homology score: 83%
ClinVar variants: 110
Gene description: Exhibits voltage-gated sodium channel activity. Involved in several processes, including larval locomotory behavior; mechanosensory behavior; and motor neuron axon guidance. Predicted to localize to axon and voltage-gated sodium channel complex. Is expressed in heart; nervous system; otic vesicle; and trigeminal placode. Human ortholog(s) of this gene implicated in benign familial neonatal epilepsy and early infantile epileptic encephalopathy 13. Orthologous to human SCN8A (sodium voltage-gated channel alpha subunit 8).
ZFIN link: https://zfin.org/ZDB-GENE-000828-1
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000005775;r=23:27251626-27345425;t=ENSDART00000022042
Zebrafish reference(s): n/a
This gene has 2 transcripts (splice variants).
WT DNA sequence (mutation area: exon 2)
Mutant DNA sequence (mutation area: 1 bp deletion in exon 2)
Guide RNA target sites: *taatacgactcactataGGGGGACATCCCTCCTGGCAgttttagagctagaa
Primers:
Forward primer: CACCTAAGCCAGACAACAGC
Reverse primer: catggcttgaggaatgttggg
WT Protein sequence
N = 83
