Zebrafish gene: scn1lab
Human gene: SCN1A (sodium voltage-gated channel alpha subunit 1)
Homology score: 68%
ClinVar variants: 803
Gene description: Predicted to have voltage-gated sodium channel activity. Involved in several processes, including neuronal action potential; regulation of generation of precursor metabolites and energy; and swimming behavior. Predicted to localize to axon and voltage-gated sodium channel complex. Is expressed in heart and nervous system. Used to study Dravet syndrome; anxiety disorder; and epilepsy. Human ortholog(s) of this gene implicated in epilepsy (multiple) and familial hemiplegic migraine 3. Orthologous to human SCN1A (sodium voltage-gated channel alpha subunit 1) and SCN2A (sodium voltage-gated channel alpha subunit 2).
ZFIN link: https://zfin.org/ZDB-GENE-060906-1
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000062744;r=6:10248332-10320676;t=ENSDART00000151247
Zebrafish reference(s): n/a
This gene has 2 transcripts (splice variants).
WT DNA sequence (mutation area: exon 11)
Mutant DNA sequence (mutation area: 7 bp deletion in exon 11)
Guide RNA target sites: taatacgactcactataGGCGGGGAGTACAGCGGAAGgttttagagctagaa
Primers:
Forward primer: actgtttgtccatgtcctgcc
Reverse primer: tttcccacaatgccacacagc
WT Protein sequence
Representative mutant behavior data
N = 92
