Zebrafish gene: scn1ba
Human gene: SCN1B (sodium voltage-gated channel beta subunit 1)
Homology score: 68%
ClinVar variants: 803
Gene description: Contributes to voltage-gated sodium channel activity. Involved in sodium ion transport. Predicted to localize to voltage-gated sodium channel complex. Is expressed in gill; heart; liver; musculature system; and nervous system. Human ortholog(s) of this gene implicated in Brugada syndrome 5; early infantile epileptic encephalopathy 52; familial atrial fibrillation; and generalized epilepsy with febrile seizures plus 1. Orthologous to human SCN1B (sodium voltage-gated channel beta subunit 1).
ZFIN link: https://zfin.org/ZDB-GENE-060503-604
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000060222;r=16:41873708-41897579;t=ENSDART00000084631
Zebrafish reference(s): n/a
This gene has 5 transcripts (splice variants).
WT DNA sequence (mutation area: exon 3)
Mutant DNA sequence (mutation area: 10 bp deletion in exon 3)
Guide RNA target sites: taatacgactcactataGGAGACCGCCTGGCCTGGAAgttttagagctagaa
Primers:
Forward primer: catagcagtctcagacgttgatg
Reverse primer: CATGTCCTACTACGCTGATGG
WT Protein sequence
N = 84
