Zebrafish gene: grin1b
Human gene: GRIN1 (glutamate ionotropic receptor NMDA type subunit 1)
Homology score: 90%
ClinVar variants: 41
Gene description: Predicted to contribute to NMDA glutamate receptor activity. Predicted to be involved in chemical synaptic transmission; ionotropic glutamate receptor signaling pathway; and regulation of membrane potential. Predicted to localize to NMDA selective glutamate receptor complex; neuron projection; and synapse. Is expressed in brain. Human ortholog(s) of this gene implicated in alcohol use disorder; autosomal dominant non-syndromic intellectual disability 8; and cerebral infarction. Orthologous to human GRIN1 (glutamate ionotropic receptor NMDA type subunit 1).
ZFIN link: https://zfin.org/ZDB-GENE-051202-2
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000025728;r=5:29599156-29643381;t=ENSDART00000034849
Zebrafish reference(s): n/a
This gene has 2 transcripts (splice variants).
WT DNA sequence (mutation area: exon 8)
Mutant DNA sequence (mutation area: 14 bp deletion in exon 8)
Guide RNA target sites: taatacgactcactataGGGCAAGTGGGCGTCTACAAgttttagagctagaa
Primers:
Forward primer: tggtgtactagAGTGCTGATG
Reverse primer: tcattgtgcactgatggctc
WT Protein sequence
Representative mutant behavior data
N = 81
Representative het EEG
