Zebrafish gene: grin1a
Human gene: GRIN1 (glutamate ionotropic receptor NMDA type subunit 1)
Homology score: 82%
ClinVar variants: 41
Gene description: Predicted to contribute to NMDA glutamate receptor activity. Predicted to be involved in chemical synaptic transmission; ionotropic glutamate receptor signaling pathway; and regulation of membrane potential. Predicted to localize to NMDA selective glutamate receptor complex; neuron projection; and synapse. Is expressed in brain; head; neural tube; presumptive neural retina; and spinal cord. Human ortholog(s) of this gene implicated in alcohol use disorder; autosomal dominant non-syndromic intellectual disability 8; and cerebral infarction. Orthologous to human GRIN1 (glutamate ionotropic receptor NMDA type subunit 1).
ZFIN link: https://zfin.org/ZDB-GENE-051202-1
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000027828;r=21:11468934-11502971;t=ENSDART00000102368
Zebrafish reference(s): n/a
This gene has 4 transcripts (splice variants).
WT DNA sequence (mutation area: exon 2)
Mutant DNA sequence (mutation area: 13 bp deletion in exon 2)
Guide RNA target sites: taatacgactcactataGGGGATGCGGTAGAAGCCAGgttttagagctagaa
Primers:
Forward primer: caatctgtgtgactgtgaagtg
Reverse primer: GTCTGAATAAATGGACATCCTGG
WT Protein sequence
N = 89
