Zebrafish gene: gnao1b
Human gene: GNAO1 (G protein subunit alpha o1)
Homology score: 71%
ClinVar variants: 34
Gene description: Predicted to have G protein-coupled receptor binding activity; G-protein beta/gamma-subunit complex binding activity; and GTPase activity. Predicted to be involved in adenylate cyclase-modulating G protein-coupled receptor signaling pathway and dopamine receptor signaling pathway. Predicted to localize to heterotrimeric G-protein complex. Is expressed in nervous system and pronephric duct. Human ortholog(s) of this gene implicated in early infantile epileptic encephalopathy 17. Orthologous to human GNAO1 (G protein subunit alpha o1).
ZFIN link: https://zfin.org/ZDB-GENE-040426-1693
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000036058;r=7:29133321-29144547;t=ENSDART00000052346
Zebrafish reference(s): n/a
This gene has 2 transcripts (splice variants).
WT DNA sequence (mutation area: exon 3)
Mutant DNA sequence (mutation area: 10 bp deletion in exon 3)
Guide RNA target sites: taatacgactcactataGGTGGCGGAGAGGCTCTGAAgttttagagctagaa
Primers:
Forward primer: cacacatcccagccatatgg
Reverse primer: caccacttcattagtcaattcgc
WT Protein sequence
N = 107
