Zebrafish gene: gnao1a
Human gene: GNAO1 (G protein subunit alpha o1)
Homology score: 91%
ClinVar variants: 34
Gene description: Predicted to have G protein-coupled receptor binding activity; G-protein beta/gamma-subunit complex binding activity; and GTPase activity. Predicted to be involved in adenylate cyclase-modulating G protein-coupled receptor signaling pathway and dopamine receptor signaling pathway. Predicted to localize to heterotrimeric G-protein complex. Is expressed in gill; nervous system; neural rod; and trigeminal placode. Human ortholog(s) of this gene implicated in early infantile epileptic encephalopathy 17. Orthologous to human GNAO1 (G protein subunit alpha o1).
ZFIN link: https://zfin.org/ZDB-GENE-040426-1757
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000016676;r=18:22793465-22975655;t=ENSDART00000149685
Zebrafish reference(s): n/a
This gene has 2 transcripts (splice variants).
WT DNA sequence (mutation area: exon 4)
Mutant DNA sequence (mutation area: 8 bp deletion in exon 4)
Guide RNA target sites: taatacgactcactataGGAGCTGGTACTCGCGGGCAgttttagagctagaa
Primers:
Forward primer: GTGATGTTGTGAGCCGTATGG
Reverse primer: tagacgctacctaatgtggcc
WT Protein sequence
N = 87
