Zebrafish gene: gabrb3
Human gene: GABRB3 (gamma-aminobutyric acid type A receptor subunit beta3)
Homology score: 78%
ClinVar variants: 20
Gene description: Predicted to have neurotransmitter receptor activity. Predicted to be involved in several processes, including chemical synaptic transmission; nervous system process; and regulation of membrane potential. Predicted to localize to integral component of plasma membrane; neuron projection; and synapse. Is expressed in eye and telencephalon. Human ortholog(s) of this gene implicated in childhood absence epilepsy and early infantile epileptic encephalopathy 43. Orthologous to human GABRB3 (gamma-aminobutyric acid type A receptor subunit beta3).
ZFIN link: https://zfin.org/ZDB-GENE-101102-2
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000023771;r=6:38381957-38513525;t=ENSDART00000087300
Zebrafish reference(s): n/a
This gene has 3 transcripts (splice variants).
WT DNA sequence (mutation area: exon 7)
Mutant DNA sequence (mutation area: 7 bp deletion + 8 bp insertion in exon 7)
Guide RNA target sites: n/a
Primers:
Forward primer: ATTAGCTCTGCATTTGTTATATATTTAGTCCAATAATGG
Reverse primer: ttgcatcgactccacaaattgcgtg
WT Protein sequence
Representative mutant behavior data
N = 86
