Zebrafish gene: gabra1
Human gene: GABRA1 (gamma-aminobutyric acid type A receptor subunit alpha1)
Homology score: 46%
ClinVar variants: 30
Gene description: Contributes to GABA-gated chloride ion channel activity. Involved in protein heterotrimerization. Predicted to localize to several cellular components, including GABA-A receptor complex; dendrite membrane; and postsynapse. Is expressed in nervous system. Used to study epilepsy with generalized tonic-clonic seizures. Human ortholog(s) of this gene implicated in early infantile epileptic encephalopathy 19 and idiopathic generalized epilepsy 13. Orthologous to human GABRA1 (gamma-aminobutyric acid type A receptor subunit alpha1).
ZFIN link: https://zfin.org/ZDB-GENE-061013-194
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000068989;r=21:42050886-42097736;t=ENSDART00000100000
Zebrafish reference(s): n/a
This gene has 3 transcripts (splice variants).
WT DNA sequence (mutation area: exon 6)
Mutant DNA sequence (mutation area: 7 bp deletion and 10 bp insertion in exon 6)
Guide RNA target sites: taatacgactcactataGGCGTGGTGCAGTCCAGCACgttttagagctagaa
Primers:
Forward primer: cagggtttcgctccaacttgcctc
Reverse primer: aagcttgtgactcaaagccacgagg
WT Protein sequence
N = 91
