Zebrafish gene: eef1a2
Human gene: EEF1A2 (eukaryotic translation elongation factor 1 alpha 2)
Homology score: 92%
ClinVar variants: 18
Gene description: Predicted to have GTPase activity and translation elongation factor activity. Predicted to be involved in translational elongation. Human ortholog(s) of this gene implicated in autosomal dominant non-syndromic intellectual disability 38; early infantile epileptic encephalopathy 33; and ovarian cancer. Orthologous to human EEF1A2 (eukaryotic translation elongation factor 1 alpha 2).
ZFIN link: https://zfin.org/ZDB-GENE-040718-64
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000006838;r=23:15850938-15878879;t=ENSDART00000010119
Zebrafish reference(s): Zhang, S.H., et al., Cloning, expression and functional study of translation elongation factor 2 (EF-2) in zebrafish. Int J Dev Biol, 2006. 50(4): p. 399-403.
This gene has 1 transcript (splice variant).
WT DNA sequence (mutation area: exon 5)
Mutant DNA sequence (mutation area: 7 bp deletion in exon 5)
Guide RNA target sites: taatacgactcactataGGAAGGAGCACCATGCCGGgttttagagctagaa
Primers:
Forward primer: CCCTTTGTCCCTATTTCAGGCTGG
Reverse primer: GTAAGGGTTTATCAGTGGGCCGTG
WT Protein sequence
Representative mutant behavior data
N = 92
