Zebrafish gene: depdc5
Human gene: DEPDC5 (DEP domain containing 5, GATOR1 subcomplex subunit)
Homology score: 67%
ClinVar variants: 106
Gene description: Predicted to contribute to GTPase activator activity. Involved in regulation of neuronal action potential and swimming behavior. Predicted to localize to GATOR1 complex and lysosomal membrane. Is expressed in central nervous system and notochord. Used to study focal epilepsy. Human ortholog(s) of this gene implicated in focal epilepsy. Orthologous to human DEPDC5 (DEP domain containing 5, GATOR1 subcomplex subunit).
ZFIN link: https://zfin.org/ZDB-GENE-091204-356
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000078105;r=10:17171604-17222083;t=ENSDART00000111088
Zebrafish reference(s): n/a
Sequences:
This gene has 6 transcripts (splice variants).
WT DNA sequence (mutation area: exon 20)
Mutant DNA sequence (mutation area: 14 bp deletion in exon 20)
Guide RNA target sites: n/a
Primers:
Forward primer: ggttggaacagcatgagagtg
Reverse primer: AGCTGCTGACCTCGTATTGG
WT Protein sequence
N = 99
