Zebrafish gene: cpa6
Human gene: CPA6 (carboxypeptidase A6)
Homology score: 74%
ClinVar variants: 1
Gene description: Exhibits carboxypeptidase activity. Predicted to be involved in proteolysis. Predicted to localize to extracellular space. Is expressed in several structures, including head; pectoral fin; pectoral fin bud; segmental plate; and tail bud. Human ortholog(s) of this gene implicated in familial febrile seizures 11 and familial temporal lobe epilepsy 5. Orthologous to human CPA6 (carboxypeptidase A6).
ZFIN link: https://zfin.org/ZDB-GENE-091204-331
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000012013;r=24:18880254-18919649;t=ENSDART00000106188
Zebrafish reference(s): n/a
This gene has 4 transcripts (splice variants).
WT DNA sequence (mutation area: exon 9)
Mutant DNA sequence (mutation area: 2 bp deletion in exon 9)
Guide RNA target sites: n/a
Primers:
Forward primer: gacaatgtaggccagaataggc
Reverse primer: CAGTTGAAGTTTGGTATAGTGGC
WT Protein sequence
N = 99
