Zebrafish gene: cntnap2a
Human gene: CNTNAP2 (contactin associated protein 2)
Homology score: 69%
ClinVar variants: 54
Gene description: Predicted to be involved in protein localization to juxtaparanode region of axon. Predicted to localize to integral component of membrane. Is expressed in anterior lateral line ganglion and posterior lateral line ganglion. Human ortholog(s) of this gene implicated in several diseases, including Pitt-Hopkins syndrome; autism spectrum disorder (multiple); communication disorder (multiple); cortical dysplasia-focal epilepsy syndrome; and social phobia. Orthologous to human CNTNAP2 (contactin associated protein 2).
ZFIN link: https://zfin.org/ZDB-GENE-120328-3
Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000058969;r=24:17417150-18179535;t=ENSDART00000185619
Zebrafish reference(s): Hoffman, E.J., et al., Estrogens Suppress a Behavioral Phenotype in Zebrafish Mutants of the Autism Risk Gene, <em>CNTNAP2</em>. Neuron. 89(4): p. 725-733.
This gene has 5 transcripts (splice variants).
WT DNA sequence (mutation area: exon 2)
Mutant DNA sequence (mutation area: 4 bp insertion in exon 2)
Guide RNA target sites: *taatacgactcactataGGGTAATGATCACTGTCCAGgttttagagctagaa
Primers:
Forward primer: CTGAGTATGGTGCTGTTTCTG
Reverse primer: TCTGCTTCCCAGGTCGAC
WT Protein sequence
N = 80
