Zebrafish gene: arxa
Human gene: ARX (aristaless related homeobox)
Homology score: 72%
ClinVar variants: 66
Gene description: Predicted to have DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Involved in forebrain development; neuron development; and pancreatic A cell development. Predicted to localize to nucleus. Is expressed in several structures, including endocrine system; floor plate; forebrain; forebrain neural keel; and neural plate. Human ortholog(s) of this gene implicated in Partington syndrome; early infantile epileptic encephalopathy 1; lissencephaly; non-syndromic X-linked intellectual disability; and syndromic X-linked intellectual disability Hedera type. Orthologous to human ARX (aristaless related homeobox).
ZFIN link: https://zfin.org/ZDB-GENE-990415-15
Ensembl link: http://uswest.ensembl.org/Danio_rerio/Gene/Summary?g=ENSDARG00000058011;r=24:23936829-23942722;t=ENSDART00000080810
Zebrafish reference(s): n/a
This gene has 1 transcript (splice variant).
WT DNA sequence (mutation area: exon 4)
Mutant DNA sequence (mutation area: 19 bp deletion and 2 bp insertion in exon 4)
Guide RNA target sites: taatacgactcactataGGCGGAGCTATTTGGGGGTGgttttagagctagaa
Primers:
Forward primer: AGCTGCTGCTGCGTTTCCAG
Reverse primer: AAGTGGGTCCAATGAAGGCTGGATG
WT Protein sequence
Representative mutant behavior data
N = 90
