Zebrafish gene: arhgef9b
Human gene: ARHGEF9 (Cdc42 guanine nucleotide exchange factor 9)
Homology score: 80%
ClinVar variants: 13
Gene description: Predicted to have guanyl-nucleotide exchange factor activity. Involved in filopodium assembly and sprouting angiogenesis. Is expressed in caudal artery; caudal vein plexus; dorsal aorta; and intersegmental vessel. Human ortholog(s) of this gene implicated in early infantile epileptic encephalopathy 8. Orthologous to human ARHGEF9 (Cdc42 guanine nucleotide exchange factor 9).
ZFIN link: https://zfin.org/ZDB-GENE-030131-7745
Ensembl link: http://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000078624;r=14:9142162-9199968;t=ENSDART00000146113
Zebrafish reference(s): n/a
This gene has 1 transcript (splice variant).
WT DNA sequence (mutation area: exon 3)
Mutant DNA sequence (mutation area: 2 bp deletion in exon 3)
Guide RNA target sites: *taatacgactcactataGGGGAGTTGGCGTTCAAGGCgttttagagctagaa
Primers:
Forward primer: tgcagTTGATCAGCGGAGGC
Reverse primer: ggaccttgtaagatgagatgag
WT Protein sequence
N = 93
