Zebrafish gene: arhgef9a
Human gene: ARHGEF9 (Cdc42 guanine nucleotide exchange factor 9)
Homology score: 90%
ClinVar variants: 13
Gene description: Predicted to have guanyl-nucleotide exchange factor activity. Is expressed in retinal ganglion cell layer. Human ortholog(s) of this gene implicated in early infantile epileptic encephalopathy 8. Orthologous to human ARHGEF9 (Cdc42 guanine nucleotide exchange factor 9).
ZFIN link: https://zfin.org/ZDB-GENE-070705-271
Ensembl link: http://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000061746;r=5:21939733-22001053;t=ENSDART00000143878
Zebrafish reference(s): n/a
This gene has 4 transcripts (splice variants).
WT DNA sequence (mutation area: exon 4)
Mutant DNA sequence (mutation area: 19 bp deletion in exon 4)
Guide RNA target sites: taatacgactcactataGGAGGAAAACACAGCGGTCGgttttagagctagaa
Primers:
Forward primer: ccatctcgacacgataatgacc
Reverse primer: CGTTCTGTGCTCATGATCTCG
WT Protein sequence
N = 85
