Zebrafish gene: aldh7a1

Human gene: ALDH7A1 (aldehyde dehydrogenase 7 family, member A1)

Homology score: 78%

ClinVar variants: 54

Gene description: Predicted to have oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor. Involved in camera-type eye development; cartilage development; and pectoral fin development. Is expressed in several structures, including alar plate midbrain region; fin bud; musculature system; nervous system; and pharyngeal arch. Used to study epilepsy. Orthologous to human ALDH7A1 (aldehyde dehydrogenase 7 family member A1).

ZFIN link: https://zfin.org/ZDB-GENE-030131-6129 

Ensembl link: https://uswest.ensembl.org/Danio_rerio/Gene/Summary?db=core;g=ENSDARG00000018426;r=10:16006905-16028082;t=ENSDART00000122540​

Zebrafish reference(s): Pena, I. A., Roussel, Y., Daniel, K., Mongeon, K., Johnstone, D., Weinschutz Mendes, H., Bosma, M., Saxena, V., Lepage, N., Chakraborty, P., Dyment, D. A., van Karnebeek, C., Verhoeven-Duif, N., Bui, T. V., Boycott, K. M., Ekker, M., & MacKenzie, A. (2017). Pyridoxine-Dependent Epilepsy in Zebrafish Caused by Aldh7a1 Deficiency. Genetics207(4), 1501–1518. https://doi.org/10.1534/genetics.117.300137

Sequences:

This gene has 1 transcript (splice variant).

Guide RNA target sites: n/a

Primers:

Forward primer: GGTTTGGTAGCATGAGACATATTGTAGC

Reverse primer: GACATGTGGTGGCGCTGACATTGG

Kaplan-Maier Survival Plot

EEG scoring distribution

N = 96

Representative mutant EEG